InovaGen Akademija©

Dizajn početnica za PCR

Kao što smo spomenuli u jednom od prijašnjih članaka o optimizaciji, za uspješnu PCR reakciju jedan od ključnih preduvjeta je dizajn početnica. Iako smo objasnili na koji način koncentracija početnica može utjecati na produkt reakcije, ostali smo dužni objasniti kako se odabiru pravilne početnice.

Početnice su kratke sintetizirane jednolančane DNA koje služe kao klica DNA polimerazi za početak sinteze novog lanca DNA.

Postoji nekoliko načina za odabir početnica:

  1. Pronalazak početnica za željeni produkt u znanstvenoj literaturi
  2. Dizajn početnica prema određenim smjernicama
  3. Dizajn početnica pomoću programa za dizajn početnica

 

Svako od ovih rješenja ima i prednosti i mane, te je svako od njih primjenjivo u različitim situacijama.

 

Pronalazak početnica za željeni produkt u znanstvenoj literaturi:

+ ako nemate poznati slijed željenog produkta, niti slijed koji obuhvaća željeni produkt

+ već je netko optimizirao i dobio dobar rezultat s postojećim početnicama

– preduvjet da je netko već istraživao regiju od vašeg interesa

– iz raznih razloga početnice u znanstvenoj literaturi mogu biti pogrešne i poželjno je provjeriti njihovo vezivanje na željeno mjesto te pravilnu orijentaciju (početnice se u pravilu navode u smjeru 5′ prema 3′ ako nije izričito naglašeno drugačije)

– veličina fragmenta obuhvaćenog početnicama iz znanstvene literature iz raznih razloga ne mora odgovarati potrebama vašeg eksperimenta

 

Dizajn početnica prema određenim smjernicama:

+ ne postoje početnice objavljene u znanstvenoj literaturi

+ software za dizajn početnica ne daje početnice koje odgovaraju potrebama eksperimenta

– zahtjevno udovoljiti svim preporučenim smjernicama

– oduzima puno vremena

 

Program za dizajn početnica:

+ jednostavno i brzo

+ on-line dostupne verzije programa

+ odabir između različitih kombinacija početnica omogućava podešavanje veličine produkta potrebama svakog eksperimenta

– poznati slijed željenog produkta

– ponekad ne daje početnice koje odgovaraju potrebama eksperimenta (rijetko, jer je moguće podešavati parametre za dizajn)

 

Ovo su osnove odabira početnica. Kako biste pravilno odabrali početnice dobro je znati koje su to zadane smjernice za dizajn, ne samo kako biste ih znali ručno odabrati, već i kako biste razumjeli programe za odabir početnica te na taj način mogli modificirati parametre. Na našim tečajevima biti ćete u mogućnosti saznati sve o dizajnu početnica te se upoznati s najkorištenijim programima.

 

Provjerite svoje razumijevanje i znanje o odabiru početnica kroz naš kviz:

Tvoje ime (obvezno)

Tvoj email (obvezno)

Vaš kolega je naručio četiri para početnica u nadi da će jedan od parova umnožiti prikazani kalup DNA. Pošto nije pohađao tečajeve u InovaGen Akademiji, ne zna osnovna pravila za odabir početnica i nije siguran u svoj odabir te vas moli za pomoć.

DNA kalup:
5’ ...GTTGTCCAGCTAGAGG...............ATTCGGATGACGATTG.........3’
3’....CAACAGGTCGATCTCC...............TAAGCCTACTGCTAAC.......5’

Koji od navedenih parova početnica je jedini pravilan za umnožavanje zadanog DNA kalupa?
 5’ ... TGTCCAGCTAGAG ...3’ & 5’ ... TCGGATGACGATTG ...3’ 5’ ... TGTCCAGCTAGAG ...3’ & 5’ ... ATCGTCATCCGAAT...3’ 5’ ... AGATCGACCTGTTG...3’ & 5’ ... ATCGTCATCCGAAT...3’ 5’ ... AGATCGACCTGTTG...3’ & 5’ ... TCGGATGACGATTG ...3’

U skladu s osnovnim smjernicama za dizajn početnica, koja od slijedećih tvrdnji je točna za početnicu 5’ ... ATCGATCGAC ...3’?
 Udio GC parova baza ne odgovara smjernicama. Duljina ne odgovara preporučenoj duljini početnice. Početnica stvara sekundarnu strukturu – „self dimer“. Početnica stvara sekundarnu strukturu ukosnice.

U skladu s osnovnim smjernicama za dizajn početnica, koja od slijedećih tvrdnji je točna za početnicu 5’ ... CGGCGCCGTCGCCTCGAC ...3’?
 Udio GC parova baza ne odgovara smjernicama. Duljina ne odgovara preporučenoj duljini početnice. Početnica stvara sekundarnu strukturu – „self dimer“. Početnica stvara sekundarnu strukturu ukosnice.

U skladu s osnovnim smjernicama za dizajn početnica, koja od slijedećih tvrdnji je točna za početnicu 5’ ... ATCGATCGACACCGATCGAT ...3’?
 Udio GC parova baza ne odgovara smjernicama. Duljina ne odgovara preporučenoj duljini početnice. Početnica stvara sekundarnu strukturu – „self dimer“. Početnica stvara sekundarnu strukturu ukosnice.

U skladu s osnovnim smjernicama za dizajn početnica, koja od slijedećih tvrdnji je točna za početnicu 5’ ... ATCGATCGACACTGCAGTG ...3’?
 Udio GC parova baza ne odgovara smjernicama. Duljina ne odgovara preporučenoj duljini početnice. Početnica stvara sekundarnu strukturu – „self dimer“. Početnica stvara sekundarnu strukturu ukosnice.

15/06/2016

0 Responses on Dizajn početnica za PCR"

Leave a Message

Vaša adresa e-pošte neće biti objavljena. Nužna polja su označena s *

Možete koristiti ove HTML oznake i atribute: <a href="" title=""> <abbr title=""> <acronym title=""> <b> <blockquote cite=""> <cite> <code> <del datetime=""> <em> <i> <q cite=""> <s> <strike> <strong>

Lokacija

InovaGen Akademija©
Radnička cesta 20/A, 10 000 Zagreb

Kontakt

E-mail:
akademija@inovagen.hr

O nama

InovaGen Akademija© nudi metodološke tečajeve iz područja molekularne biologije. Saznajte više
vrh
InovaGen Akademija© 2015